ID: 947754424_947754438

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 947754424 947754438
Species Human (GRCh38) Human (GRCh38)
Location 2:232551105-232551127 2:232551158-232551180
Sequence CCTCTGAATCCAGCTTTCCCCAC TCTCATCTGCAGAGTGGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 305} {0: 1, 1: 2, 2: 11, 3: 96, 4: 536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!