|
Left Crispr |
Right Crispr |
| Crispr ID |
947754431 |
947754438 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:232551139-232551161
|
2:232551158-232551180
|
| Sequence |
CCCCTCTGAGCCTCAGTTTTCTC |
TCTCATCTGCAGAGTGGGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 81, 1: 777, 2: 2868, 3: 6585, 4: 11343} |
{0: 1, 1: 2, 2: 11, 3: 96, 4: 536} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|