|
Left Crispr |
Right Crispr |
| Crispr ID |
947771930 |
947771933 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:232676881-232676903
|
2:232676905-232676927
|
| Sequence |
CCTGGACACTTTGGGAAGCTGAG |
CAGGAGAACTCCTCAAACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 3, 2: 58, 3: 541, 4: 3459} |
{0: 1, 1: 7, 2: 260, 3: 4840, 4: 48150} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|