ID: 947779636_947779642

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 947779636 947779642
Species Human (GRCh38) Human (GRCh38)
Location 2:232746588-232746610 2:232746635-232746657
Sequence CCCCATAAAAATATATTATTTTA CCCCAAGTTCTGTTCTTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 230, 4: 1824} {0: 1, 1: 0, 2: 1, 3: 20, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!