ID: 947791013_947791021

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 947791013 947791021
Species Human (GRCh38) Human (GRCh38)
Location 2:232869364-232869386 2:232869402-232869424
Sequence CCTTAGCGCGGTGGGAAACCATC GGGCGCTGACAGAACTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22} {0: 1, 1: 0, 2: 1, 3: 2, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!