ID: 947792044_947792055

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 947792044 947792055
Species Human (GRCh38) Human (GRCh38)
Location 2:232873947-232873969 2:232873976-232873998
Sequence CCCATGGGGCCTCCTGCCAGAGG CTGGAAAGGGGTTCTGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 235} {0: 1, 1: 0, 2: 0, 3: 12, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!