ID: 947792947_947792955

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 947792947 947792955
Species Human (GRCh38) Human (GRCh38)
Location 2:232878138-232878160 2:232878179-232878201
Sequence CCTGTGGGAAGACGCTACAAAGT GAGGCCTGTTCTGGCGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 67} {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!