ID: 947795972_947795977

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 947795972 947795977
Species Human (GRCh38) Human (GRCh38)
Location 2:232894239-232894261 2:232894264-232894286
Sequence CCTGCTGGAAGCACAGCTCCCAG CTGTGGAAAACGCACTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 319} {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!