ID: 947810198_947810208

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 947810198 947810208
Species Human (GRCh38) Human (GRCh38)
Location 2:232999360-232999382 2:232999396-232999418
Sequence CCCTCCCCTTGTCTCTGACCCAG TGCTGCATTGTGTCGGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 90, 4: 542} {0: 1, 1: 0, 2: 1, 3: 8, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!