ID: 947821911_947821918

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 947821911 947821918
Species Human (GRCh38) Human (GRCh38)
Location 2:233078149-233078171 2:233078177-233078199
Sequence CCTTCTGGCCTCAGCAGCCGATG CATGGGTGTTAGCTGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176} {0: 1, 1: 0, 2: 1, 3: 19, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!