ID: 947827050_947827054

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 947827050 947827054
Species Human (GRCh38) Human (GRCh38)
Location 2:233113617-233113639 2:233113651-233113673
Sequence CCTATCTCATTAAATATCACCAA TTACTGCAGCCAGAGATCTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 336} {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!