ID: 947847775_947847780

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 947847775 947847780
Species Human (GRCh38) Human (GRCh38)
Location 2:233259363-233259385 2:233259380-233259402
Sequence CCTCTTGGGCATTCACACAGGCC CAGGCCCAGTTGAAGGGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 163} {0: 1, 1: 0, 2: 1, 3: 48, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!