ID: 947855472_947855477

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 947855472 947855477
Species Human (GRCh38) Human (GRCh38)
Location 2:233320846-233320868 2:233320862-233320884
Sequence CCTGCTTCCTTCACCCGCAGCAC GCAGCACCTTATCATGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 254} {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!