ID: 947866341_947866355

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 947866341 947866355
Species Human (GRCh38) Human (GRCh38)
Location 2:233400411-233400433 2:233400463-233400485
Sequence CCCTTTGCCCTTCACACCCAGTG TGTCCTGGCCTGGGCCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 301} {0: 1, 1: 0, 2: 6, 3: 65, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!