ID: 947869233_947869243

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 947869233 947869243
Species Human (GRCh38) Human (GRCh38)
Location 2:233423755-233423777 2:233423777-233423799
Sequence CCCCTTCCTGGATCCTTGGCCTG GGAAGAGCAGGCTTTTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 323} {0: 1, 1: 2, 2: 13, 3: 69, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!