ID: 947904364_947904376

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 947904364 947904376
Species Human (GRCh38) Human (GRCh38)
Location 2:233749631-233749653 2:233749674-233749696
Sequence CCACCAAATCTCATCTTGAATTG TGTCAAGGACAGGATCTGGTGGG
Strand - +
Off-target summary {0: 85, 1: 383, 2: 1418, 3: 2181, 4: 2616} {0: 1, 1: 0, 2: 14, 3: 114, 4: 743}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!