ID: 947913958_947913964

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 947913958 947913964
Species Human (GRCh38) Human (GRCh38)
Location 2:233819952-233819974 2:233819988-233820010
Sequence CCCAGAGGTGCGGCGCCTTCTCA GCTGCTGGCGCACCACCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74} {0: 1, 1: 0, 2: 0, 3: 16, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!