ID: 947919640_947919646

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 947919640 947919646
Species Human (GRCh38) Human (GRCh38)
Location 2:233857955-233857977 2:233858002-233858024
Sequence CCACCTATTAGGCTGCTAAGAAA TAGAGCTGATGCAAACACAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!