ID: 947992238_947992248

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 947992238 947992248
Species Human (GRCh38) Human (GRCh38)
Location 2:234496983-234497005 2:234497001-234497023
Sequence CCTGCTCCCGCTCCCGCTCCCGG CCCGGAGCGCGGGCTTCCCCGGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 44, 3: 220, 4: 1438} {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!