ID: 948014505_948014512

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 948014505 948014512
Species Human (GRCh38) Human (GRCh38)
Location 2:234677046-234677068 2:234677098-234677120
Sequence CCTGGGGCACAGGGGCACAAGAA CATCTGAGTGCCCAGGGAAGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 4, 3: 30, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!