ID: 948015089_948015101

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 948015089 948015101
Species Human (GRCh38) Human (GRCh38)
Location 2:234682612-234682634 2:234682655-234682677
Sequence CCACGAGTCTCTTGCCCTCCTGG GCATGTTCTTTTCATAGTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 6, 3: 37, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!