ID: 948015099_948015102

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 948015099 948015102
Species Human (GRCh38) Human (GRCh38)
Location 2:234682637-234682659 2:234682666-234682688
Sequence CCAGAGAGGCCAGTTGGGGCATG TCATAGTGAAGGCAGACCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!