ID: 948046555_948046559

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 948046555 948046559
Species Human (GRCh38) Human (GRCh38)
Location 2:234950676-234950698 2:234950701-234950723
Sequence CCTCTGTCCACCTGTGTCTCCTG ACTTCAACACAGACTTCAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!