ID: 948051121_948051134

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 948051121 948051134
Species Human (GRCh38) Human (GRCh38)
Location 2:234980151-234980173 2:234980170-234980192
Sequence CCCCTGTAAGTAGTCCCCCCCTT CCTTATCTGCAGGGGATACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84} {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!