ID: 948052684_948052688

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 948052684 948052688
Species Human (GRCh38) Human (GRCh38)
Location 2:234990556-234990578 2:234990578-234990600
Sequence CCCTGAAAGACTCAGCTCTGCAG GCGTGGACCAGCTCTTGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 255} {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!