ID: 948061111_948061118

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 948061111 948061118
Species Human (GRCh38) Human (GRCh38)
Location 2:235043893-235043915 2:235043935-235043957
Sequence CCAAGGACCCTGCAAAGAAGAGC CCGAATCTGTGAGCTCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 199} {0: 1, 1: 0, 2: 2, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!