ID: 948061474_948061480

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 948061474 948061480
Species Human (GRCh38) Human (GRCh38)
Location 2:235045766-235045788 2:235045783-235045805
Sequence CCACCGCTTTACCTGCCCCTCCC CCTCCCAGAGAGTCACAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 683} {0: 1, 1: 0, 2: 0, 3: 26, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!