ID: 948062785_948062796

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 948062785 948062796
Species Human (GRCh38) Human (GRCh38)
Location 2:235053854-235053876 2:235053886-235053908
Sequence CCCTCTTCTGCCCTGCGTGCCCT GCGGAGCTGAAGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 347} {0: 1, 1: 0, 2: 6, 3: 113, 4: 1230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!