ID: 948071965_948071975

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 948071965 948071975
Species Human (GRCh38) Human (GRCh38)
Location 2:235135152-235135174 2:235135188-235135210
Sequence CCCTCAGACAGGCCCCTTCCAAT GGCCCCTTCCAGTTCACCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!