ID: 948090392_948090400

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 948090392 948090400
Species Human (GRCh38) Human (GRCh38)
Location 2:235288734-235288756 2:235288776-235288798
Sequence CCGGCCCCAATCTCCTAATTCTG GCTAGCACACTGCTACCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 279} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!