ID: 948093488_948093498

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 948093488 948093498
Species Human (GRCh38) Human (GRCh38)
Location 2:235315127-235315149 2:235315171-235315193
Sequence CCTGTGGCTCACCCCTGTAATCC TGGCACAATCGCTTGAGCCCAGG
Strand - +
Off-target summary {0: 32, 1: 2019, 2: 2850, 3: 2402, 4: 1534} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!