ID: 948116007_948116023

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 948116007 948116023
Species Human (GRCh38) Human (GRCh38)
Location 2:235494581-235494603 2:235494617-235494639
Sequence CCGGCTCCCCGGGGGCTGCGGCG GGCCCGCGGGCCCCGGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 626} {0: 1, 1: 0, 2: 4, 3: 99, 4: 735}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!