ID: 948116244_948116257

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 948116244 948116257
Species Human (GRCh38) Human (GRCh38)
Location 2:235495606-235495628 2:235495655-235495677
Sequence CCCGCTTCCCTCTGCATGTCAGG ACAGCAGCAGTCTGCCTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 295} {0: 1, 1: 0, 2: 2, 3: 23, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!