ID: 948123009_948123016

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 948123009 948123016
Species Human (GRCh38) Human (GRCh38)
Location 2:235544669-235544691 2:235544696-235544718
Sequence CCCCTGCTGGATTGTAGATGGCC AAACCAATGCTGCCTCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 163} {0: 1, 1: 1, 2: 3, 3: 13, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!