ID: 948123010_948123016

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 948123010 948123016
Species Human (GRCh38) Human (GRCh38)
Location 2:235544670-235544692 2:235544696-235544718
Sequence CCCTGCTGGATTGTAGATGGCCC AAACCAATGCTGCCTCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 132} {0: 1, 1: 1, 2: 3, 3: 13, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!