ID: 948123011_948123016

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 948123011 948123016
Species Human (GRCh38) Human (GRCh38)
Location 2:235544671-235544693 2:235544696-235544718
Sequence CCTGCTGGATTGTAGATGGCCCC AAACCAATGCTGCCTCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 105} {0: 1, 1: 1, 2: 3, 3: 13, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!