ID: 948125704_948125709

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 948125704 948125709
Species Human (GRCh38) Human (GRCh38)
Location 2:235563425-235563447 2:235563442-235563464
Sequence CCCACTTTCCTCTGCCCAGGCAG AGGCAGAAACTAAGATGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 386} {0: 1, 1: 0, 2: 0, 3: 28, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!