ID: 948130591_948130596

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 948130591 948130596
Species Human (GRCh38) Human (GRCh38)
Location 2:235597675-235597697 2:235597710-235597732
Sequence CCCGCTGGGGCCCTGTCTGTGTG GCTCCCGTGTTTCCTGTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 42, 4: 392} {0: 1, 1: 7, 2: 1, 3: 7, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!