ID: 948131691_948131696

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 948131691 948131696
Species Human (GRCh38) Human (GRCh38)
Location 2:235605514-235605536 2:235605538-235605560
Sequence CCGGCATCATTTATCTTCTCCCT CCTTGTTGCCAAGGCACGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 471} {0: 1, 1: 0, 2: 1, 3: 8, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!