ID: 948133587_948133599

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 948133587 948133599
Species Human (GRCh38) Human (GRCh38)
Location 2:235619650-235619672 2:235619683-235619705
Sequence CCCATGTCCACCCCTTTAATTTC TGGGCTGGCTGCACTAGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 351} {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!