ID: 948147297_948147304

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 948147297 948147304
Species Human (GRCh38) Human (GRCh38)
Location 2:235717098-235717120 2:235717122-235717144
Sequence CCCAAGTCTACCCTAGACTCATC CCTAAAGATGCTACCATGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 87} {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!