ID: 948155306_948155315

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 948155306 948155315
Species Human (GRCh38) Human (GRCh38)
Location 2:235776719-235776741 2:235776732-235776754
Sequence CCCTCCCCCTTCCCCTTGCACAC CCTTGCACACCTTGTACTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 125, 4: 1342} {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!