ID: 948171768_948171777

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 948171768 948171777
Species Human (GRCh38) Human (GRCh38)
Location 2:235909556-235909578 2:235909609-235909631
Sequence CCTTCCCATGTCTGCTCATCAGA ATAAACACACACACAGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 249} {0: 1, 1: 1, 2: 31, 3: 207, 4: 1345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!