ID: 948190082_948190095

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 948190082 948190095
Species Human (GRCh38) Human (GRCh38)
Location 2:236051641-236051663 2:236051687-236051709
Sequence CCAAAGAGCAGAAGCAGGAAGGG TAAAAGCGACCCTGGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 511} {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!