ID: 948190861_948190876

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 948190861 948190876
Species Human (GRCh38) Human (GRCh38)
Location 2:236057552-236057574 2:236057600-236057622
Sequence CCCCCCCCTCAACCCCCGTGTTT CCTGACCCAACACTGCGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 308} {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!