ID: 948193925_948193931

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 948193925 948193931
Species Human (GRCh38) Human (GRCh38)
Location 2:236080948-236080970 2:236080978-236081000
Sequence CCGTATCTGCAGTTAGGTTGCCA TCACATAGTCACAGGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126} {0: 1, 1: 4, 2: 35, 3: 209, 4: 575}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!