|
Left Crispr |
Right Crispr |
| Crispr ID |
948193927 |
948193932 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:236080968-236080990
|
2:236080984-236081006
|
| Sequence |
CCATGTAAGGTCACATAGTCACA |
AGTCACAGGTCCTGGGGATTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 20, 2: 169, 3: 509, 4: 931} |
{0: 1, 1: 30, 2: 217, 3: 655, 4: 1615} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|