ID: 948197793_948197805

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 948197793 948197805
Species Human (GRCh38) Human (GRCh38)
Location 2:236108126-236108148 2:236108161-236108183
Sequence CCGTCCCTCCGCCTGACCCCCTA AGGGAGAAGGCATGCATGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 484} {0: 1, 1: 0, 2: 5, 3: 45, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!