ID: 948201627_948201638

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 948201627 948201638
Species Human (GRCh38) Human (GRCh38)
Location 2:236133582-236133604 2:236133612-236133634
Sequence CCCTCATGCCTCCACTTACACAC CAGACTGGGCGGGGTCCCTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!