ID: 948219396_948219398

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 948219396 948219398
Species Human (GRCh38) Human (GRCh38)
Location 2:236257700-236257722 2:236257722-236257744
Sequence CCTGCTCTGCTCCTAACTGGCTG GTTGACCAGCAAGTGAACACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 28, 3: 208, 4: 1059} {0: 1, 1: 1, 2: 1, 3: 8, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!